This is a working overview of stability, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2026-03-01. Anything still debated is marked as such rather than presented as settled.
Analytical confirmation usually combines a separation method with a copper-specific measurement. Liquid chromatography or mass spectrometry establishes peptide identity and purity, while an elemental measurement quantifies the metal content. A frequent misconception is that any blue solution contains an intact copper peptide complex; color alone does not confirm structure, because free copper salts and degraded mixtures can also appear colored. Literature on efficacy is mixed, with in vitro findings often more dramatic than human evidence, and reviews note small sample sizes and short follow-up. Open questions include optimal concentration, skin penetration, and long-term effects.
Proposed mechanisms for copper peptide activity center on delivery of copper ions to cells and on peptide fragments acting as signaling molecules. Copper is a cofactor for enzymes involved in collagen cross-linking and antioxidant defense, and the peptide may improve its availability at target sites. Separately, the tripeptide and its breakdown products have been reported to influence gene expression in cultured fibroblasts. Much of this evidence comes from laboratory cell cultures and animal models rather than controlled human trials. The relative contribution of the copper ion and the peptide sequence is therefore not fully settled.
Stability depends on temperature, light exposure, moisture, and the presence of oxidizing or reducing agents. Solid material held dry and protected from light is generally more stable than aqueous solutions, which can undergo gradual degradation. Recommended storage in much of the literature is a freezer at around minus twenty degrees Celsius for long-term retention, with working aliquots kept cold and shielded from light. Repeated freeze-thaw cycles and alkaline pH are commonly noted as factors that accelerate loss of the intact complex, though exact degradation rates vary.
The molecular weight and charge of GHK-Cu depend on the pH and the number of coordinated ligands. At neutral pH, the peptide typically binds one copper ion, but ternary complexes with other biomolecules can form. Spectroscopic methods such as electron paramagnetic resonance and circular dichroism are used to study the coordination environment. Reports on the exact geometry vary because the complex is dynamic in solution. Researchers often use synthetic GHK-Cu rather than extracted material to control stoichiometry and purity.
GHK-Cu is a coordination complex formed from the tripeptide glycyl-L-histidyl-L-lysine and a copper(II) ion. The peptide binds copper through its histidine imidazole nitrogen, the terminal amino group, and the deprotonated amide nitrogen. This arrangement creates a square-planar or distorted geometry around the metal center, depending on pH and the presence of competing ligands. The complex occurs naturally in human plasma, saliva, and urine at low concentrations, and its sequence is conserved across many vertebrate species.
Discovery of GHK is generally attributed to work in the 1970s that isolated a plasma factor influencing liver cell behavior. Subsequent studies identified the copper-binding tripeptide and its ability to chelate copper with high affinity. Early reports linked the complex to wound healing and tissue remodeling in animal models. The free peptide and the copper-bound form have different properties, so the two are distinguished in the literature. Whether endogenous GHK-Cu serves a single primary physiological role remains an open question.
| Property | Value | Notes |
|---|---|---|
| Typical storage temperature | -20 °C | Dry, protected from light |
| Appearance in solution | Blue | Tone varies with pH and concentration |
| Primary analytical method | LC-MS with ICP-MS | Identity plus copper content |
| pH sensitivity | Higher near neutral and above | Alkaline conditions can degrade it |
| Common supplied form | Freeze-dried solid | Dissolved before use |
The peptide sequence places a histidine in the middle, and this residue dominates metal binding. Copper(II) coordinates through the imidazole nitrogen of histidine and the terminal amino group, forming a stable chelate ring system. Loss of the copper ion leaves the free tripeptide, which has different solubility and reactivity. This structural detail matters because assays that measure only the peptide backbone can miss whether copper is still bound to it.
Several names circulate for the same material, which complicates literature searches. Cosmetic ingredient lists often use copper tripeptide-1, while older biochemistry papers use glycyl-L-histidyl-lysine or its abbreviation GHK. The copper complex is sometimes written as GHK-Cu(II) to make the oxidation state explicit. Terminology is not fully standardized, so matching a compound across sources requires attention to the exact sequence, the counterion, and the stated copper content. Reviews that compare studies must account for these naming differences before drawing conclusions.
GHK-Cu is the copper(II) complex of the tripeptide glycyl-L-histidyl-L-lysine, a short sequence of three amino acids. The peptide was first isolated from human plasma in 1973 during research on factors that influence tissue repair in liver. Its ability to bind copper ions became a central point of interest because the metal changes the peptide's chemistry and its behaviour in laboratory systems. Today the compound appears in cosmetic formulations, cell-culture studies, and biochemistry literature under several names.
Identity and purity are assessed mainly by reversed-phase high-performance liquid chromatography with ultraviolet detection, often paired with mass spectrometry to confirm the expected mass. Copper content is measured separately by inductively coupled plasma optical emission spectrometry or atomic absorption spectroscopy, because the peptide assay alone does not establish the metal-to-peptide ratio. Visible spectroscopy provides a rapid check on complex integrity through the absorption band in the visible region. Agreement between the peptide assay and the copper assay is the practical test of whether a sample is the intended complex rather than a mixture.
Aqueous solutions of GHK-Cu are less stable than the dry powder. The peptide backbone is vulnerable to hydrolysis at extreme pH, and copper can be stripped from the complex by strong chelating agents such as EDTA or citrate. Oxidising agents and high concentrations of ascorbic acid can reduce copper(II) and change the complex, which is one reason formulators often keep such ingredients in separate phases. How quickly these changes occur under real storage conditions depends on pH, buffer, temperature and packaging, and quantitative data on the subject are limited.
Identity and purity are normally checked by reversed-phase high-performance liquid chromatography, often coupled to mass spectrometry. The peptide absorbs in the ultraviolet region, and the copper complex also shows a broad visible absorption band that can be followed spectroscopically. Copper content is measured separately, for example by inductively coupled plasma mass spectrometry or atomic absorption spectroscopy, because the peptide assay alone does not confirm how much metal is bound. Purity figures therefore need a stated basis: peptide peak area, copper content, or both.
Aqueous GHK-Cu solutions are less stable than the dry powder. Light, dissolved oxygen and elevated temperature all accelerate loss of the intact complex, and the main observable changes are fading of the blue colour and the appearance of peptide fragments. Acidic conditions protonate the histidine imidazole and weaken copper binding, while strongly alkaline conditions promote hydrolysis of the peptide backbone. Because several degradation routes operate at once, a single shelf-life figure does not describe all storage conditions.
Material described in research and cosmetic supply chains is typically a synthetic peptide supplied as a lyophilized powder. Purity is commonly reported through chromatographic separation, often at 95 percent or higher, while copper content is confirmed by separate elemental analysis. Batch variation in color and solubility can reflect residual counter-ions, moisture, or partial oxidation of the peptide. Because the complex is not a single regulatory entity, specifications differ between suppliers and are not standardized internationally.
GHK-Cu is a coordination complex formed between the tripeptide glycyl-L-histidyl-L-lysine and a copper(II) ion. The peptide binds copper through its histidine imidazole nitrogen, its terminal amino group, and a deprotonated amide nitrogen, creating a stable chelate ring. The resulting complex carries a distinctive blue to blue-violet color, which arises from copper d-d electronic transitions. In the solid state it is usually handled as a powder, while in solution the complex can dissociate and re-form depending on pH and competing ligands. The name copper tripeptide-1 is widely used in ingredient listings.
The tripeptide was first isolated from a human plasma filtrate in 1973 during studies of tissue repair factors. Later work detected the free peptide and its copper complex in saliva, urine, and wound fluid, suggesting a natural role in tissue remodeling. Plasma concentrations reported in early literature decline with age, a pattern often cited in discussions of skin aging. Whether these endogenous levels are directly functional or largely incidental remains an open question. The peptide sequence is conserved across mammalian species.
There have been proposals for reactors that consume nuclear waste and transmute it to other, less-harmful or shorter-lived, nuclear waste. In particular, the integral fast reactor was a proposed nuclear reactor with a nuclear fuel cycle that produced no transuranic waste and, in fact, could consume transuranic waste. It proceeded as far as large-scale tests but was eventually canceled by the U.S. Government. Another approach, considered safer but requiring more development, is to dedicate subcritical reactors to the transmutation of the left-over transuranic elements. An isotope that is found in nuclear waste and that represents a concern in terms of proliferation is Pu-239. The large stock of plutonium is a result of its production inside uranium-fueled reactors and of the reprocessing of weapons-grade plutonium during the weapons program. An option for getting rid of this plutonium is to use it as a fuel in a traditional light-water reactors (LWR). Several fuel types with differing plutonium destruction efficiencies are under study. Transmutation was banned in the United States in April 1977 by U. S. President Carter due to the danger of plutonium proliferation, but President Reagan rescinded the ban in 1981. Due to economic losses and risks, the construction of reprocessing plants during this time did not resume. Due to high energy demand, work on the method has continued in the European Union (EU). This has resulted in a practical nuclear research reactor called Myrrha in which transmutation is possible.
== Pharmaceutical variants == The recombinant human G-CSF (rhG-CSF) synthesised in an E. coli expression system is called filgrastim. The structure of filgrastim differs slightly from the structure of the natural glycoprotein. Most published studies have used filgrastim. The Food and Drugs Administration (FDA) first approved filgrastim on February 20, 1991, marketed by Amgen with the brand name Neupogen. It was initially approved to reduce the risk of infection in patients with non-myeloid malignancies who are taking myelosuppressive anti-cancer drugs associated with febrile neutropenia with fever. Several bio-generic versions are now also available in markets such as Europe and Australia. Filgrastim (Neupogen) and PEG-filgrastim (Neulasta), or pegylated form of filgratim, are two commercially available forms of rhG-CSF. The pegylated form of filgratim form has a much longer half-life, reducing the necessity of daily injections. The FDA approved the first biosimilar of Neulasta in June 2018. It is made by Mylan and sold as Fulphila. Another form of rhG-CSF called lenograstim is synthesised in Chinese hamster ovary cells (CHO cells). As this is a mammalian cell expression system, lenograstim is indistinguishable from the 174-amino acid natural human G-CSF. No clinical or therapeutic consequences of the differences between filgrastim and lenograstim have yet been identified, but there are no formal comparative studies.
3 January 1919: to avoid anarchy in Greater Poland, the Commission of the NRL decides to take over control of the spontaneous uprising but also decides that the decision should be kept secret. 4 January 1919: The Commission of the NRL decrees a new president of the Province of Poznań, Wojciech Trąmpczyński. German authorities call for boycotting him. 5 January 1919: Czarnków, Jutrosin, Kruszwica, Nakło, Nowy Tomyśl, Miejska Górka, Rawicz, Strzelno and Wolsztyn are captured by the Poles. 6 January 1919 The Poles capture Ławica Airport, Poznań, with all aircraft undamaged. Fighting near Czersk and Kościerzyna in Pomerania. Inowrocław captured. 7 January 1919 The Poles divide captured lands into seven Military Districts (Okręg Wojskowy). The Germans recapture Chodzież and Czarnków. 8 January 1919 The Commission of the NRL takes all civil and military authority without declaring territorial range of that power. It also promotes General Józef Dowbor-Muśnicki to commander-in-chief of the uprising forces. The Poles recapture Chodzież Battle of Chodzież and Czarnków. They also win the Battle of Ślesin and capture Sieraków. 9 January 1919 The NRL officially announces that it takes control over Greater Poland. Beginning of polonisation of administration, most former anti-Polish officials being fired. In powiats, German landrats are subordinated to Polish starostas, which take all their power. Poles lose Nakło. Polish airmen bomb military airfield in Frankfurt (Oder) 10 January 1919: fights on southern front near Kąkolewo, Leszno and Rydzyna. Poles capture Sarnowa.
==== Hepatitis ==== In this pattern, hepatocellular necrosis is associated with infiltration of inflammatory cells. There can be three types of drug-induced hepatitis. (A) viral hepatitis is the most common, where histological features are similar to acute viral hepatitis. (B) in focal or non-specific hepatitis, scattered foci of cell necrosis may accompany lymphocytic infiltration. (C) chronic hepatitis is very similar to autoimmune hepatitis clinically, serologically, and histologically.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Sources: en.wikipedia.org
After Trump's victory in the 2016 elections, Sanders suggested the Democratic Party undergo a series of reforms and that it "break loose from its corporate establishment ties and, once again, become a grass-roots party of working people, the elderly and the poor." He drew parallels between his campaign and that of the Labour Party in the 2017 UK general election. He wrote in The New York Times that "the British elections should be a lesson for the Democratic Party" and urged the Democrats to stop holding on to an "overly cautious, centrist ideology", arguing that "momentum shifted to Labour after it released a very progressive manifesto that generated much enthusiasm among young people and workers." He had earlier praised Jeremy Corbyn's stance on class issues. Sanders is one of two independents in the Senate, along with Angus King, both of whom caucus with the Democrats.
==== Nanoparticles ==== An efficient way to synthesize protein-polymer hybrid nanoparticles is to take advantage of photoinitiated reversible addition−fragmentation chain transfer (RAFT) polymerization-induced self-assembly(PISA) by using multi-RAFT modified bovine serum albumin (BSA) as a macromolecular chain transfer agent. RAFT mediated growth of the PHPMA chains will graft from the BSA-RAFT, and increase the hydrophobicity of the star BSA−PHPMA conjugates. At the critical aggregation concentration, they form nanoparticles due to the hydrophobic interactions. The resulting nanoparticles show excellent encapsulation capability for both hydrophobic and hydrophilic molecules, such as cancer drugs and DNA. A rather easy method to prepare protein-polymer hybrid nanoparticles is nanoprecipitation. Spherical nanoparticles composed of BSA-PMMA with diameters of around 100 nm were obtained and the water insoluble chemotherapeutic drug camptothecin was encapsulated within the hydrophobic core consisting of PMMA. Such protein-polymer hybrid nanoparticles possess tunable sizes and surface charges, have attractive bio-compatibilities and allow efficient cell uptake. Camptothecin-encapsulated BSA-PMMA nanoparticles revealed enhanced anti-tumor activity both in vitro and in animals. Beyond the nanoscale, protein-polymer conjugate could also be used as building blocks for constructing more complicated structures such as microcapsules through hydrophobic interactions.
== Applications == The use of and results from differential refractometers are valuable in numerous fields of science, with its theory and function applied in various research directions, including drug analysis and nanoparticle tracking. The nature of refractive indexes allows RIDs to be used in conjunction with additional analytical chemistry instruments. Following the use of other machines, differential refractometers can immediately (further) characterize compounds eluting from chromatographers, spectrometers, and detectors, including:
where {ML} is the activity of the chemical species ML etc. K⊖ is dimensionless since activity is dimensionless. Activities of the products are placed in the numerator; activities of the reactants are placed in the denominator. See activity coefficient for a derivation of this expression. Since activity is the product of concentration and activity coefficient (γ) the definition could also be written as
Sources: en.wikipedia.org
=== Signaling after internalisation === KOR undergoes agonist-mediated GRK-dependent phosphorylation followed by β-arrestin recruitment, initiating clathrin-mediated endocytosis. KOR trafficking differs compared to other opioid receptors. Whereas the μ-opioid receptor (MOR) contains a C-terminal LENL recycling motif that engages retromer complexes for rapid plasma membrane recycling, and the δ-opioid receptor (DOR) undergoes predominantly lysosomal degradation following internalization, KOR requires a PDZ domain-binding sequence for post-endocytic sorting. Following internalization, KOR rapidly accumulates in early endosomes, where it remains partially dissociated from β-arrestin, allowing continued G protein coupling and signaling in compartment-specific contexts. KOR-mediated signaling persists within late endosomes and lysosomes despite agonist-induced translocation from the plasma membrane, representing a form of sustained "post-internalization" signaling distinct from plasma membrane coupling. Dynorphin A maintains prolonged adenylyl cyclase suppression when KOR is sequestered within late endosomal and lysosomal compartments, which suggests that dynorphin isoforms differentially stabilize intracellular receptor conformations suited to late-compartment signaling. This property distinguishes KOR from MOR, which primarily signals from endosomal compartments when β-arrestin-bound, and from classical recycling receptors that rapidly regain surface expression.
Hydrocodone/ibuprofen, sold under the brand name Vicoprofen among others, is a fixed-dose combination analgesic medication used in short-term therapy to relieve severe pain. Hydrocodone/ibuprofen contains hydrocodone bitartrate, an opioid analgesic agent; and ibuprofen, a nonsteroidal anti-inflammatory agent.
=== Characteristics === Unintentional weight loss may result from loss of body fats, loss of body fluids, muscle atrophy, or a combination of these. It is generally regarded as a medical problem when at least 10% of a person's body weight has been lost in six months or 5% in the last month. Another criterion used for assessing weight that is too low is the body mass index (BMI). However, even lesser amounts of weight loss can be a cause for serious concern in a frail elderly person. Unintentional weight loss can occur because of an inadequately nutritious diet relative to a person's energy needs (generally called malnutrition). Disease processes, changes in metabolism, hormonal changes, medications or other treatments, disease- or treatment-related dietary changes, or reduced appetite associated with a disease or treatment can also cause unintentional weight loss. Poor nutrient utilization can lead to weight loss, and can be caused by fistulae in the gastrointestinal tract, diarrhea, drug-nutrient interaction, enzyme depletion and muscle atrophy. Continuing weight loss may deteriorate into wasting, a vaguely defined condition called cachexia. Cachexia differs from starvation in part because it involves a systemic inflammatory response. It is associated with poorer outcomes. In the advanced stages of progressive disease, metabolism can change so that they lose weight even when they are getting what is normally regarded as adequate nutrition and the body cannot compensate.
==== Welders ==== People who work as welders can be exposed to metal fumes because welding uses extremely high heat, which turns the metal into very small airborne particles. These fumes often contain metals like manganese, chromium, nickel, and lead, depending on the materials being welded. Breathing in these particles over time can lead to different health issues, including neurological symptoms associated with manganese and lung irritation from the fumes. Stainless steel welding can also create hexavalent chromium, which is a known carcinogen. Exposures to metals are regulated in most countries. In the US, the Occupational Safety and Health Administration (OSHA) sets permissible exposure limits for metals found in welding fumes, while the National Institute for Occupational Safety and Health (NIOSH) identifies recommended exposure limits. Using some industrial hygiene controls such as local exhaust ventilation, fume extraction systems, respirators, and routine air monitoring can help protect welders from harmful metal exposure. Because welding is widely used in construction and manufacturing and many more occupations, controlling metal fumes is essential for maintaining worker health and safety.
The capacity to be metabolized by 5α-reductase and the AR activity of the resultant metabolites appears to be one of the major, if not the most important determinant of the androgenic–myotrophic ratio for a given AAS. AAS that are not potentiated by 5α-reductase or that are weakened by 5α-reductase in androgenic tissues have a reduced risk of androgenic side effects such as acne, androgenic alopecia (male-pattern baldness), hirsutism (excessive male-pattern hair growth), benign prostatic hyperplasia (prostate enlargement), and prostate cancer, while incidence and magnitude of other effects such as muscle hypertrophy, bone changes, voice deepening, and changes in sex drive show no difference.
Sources: en.wikipedia.org
Freezer temperatures are common for long-term retention. Light and moisture exposure should be limited. Working portions are best kept cold and used without repeated freeze-thaw cycles.
Sequence assays confirm the amino acids but say nothing about the metal. Copper content links the peptide to the ion that defines the complex. An elemental technique is used for this step.
No. Several copper species and degraded mixtures can also look blue. Confirmation needs both separation data and elemental data.
GHK-Cu is a complex of the tripeptide glycyl-L-histidyl-L-lysine with copper(II). The peptide coordinates the metal through its histidine imidazole, terminal amino group, and amide nitrogen. It is studied in biochemistry and dermatological research.